You are here

×

Error message

Warning: count(): Parameter must be an array or an object that implements Countable in bootstrap_table() (line 238 of /var/www/html/sites/all/themes/bootstrap/templates/system/table.func.php).

Development and testing of in vivo selection method for saliva from wild boars to the possibility of african swine fever monitoring studies

This paper presents data on the development and testing in 2013 year in vivo method of selection of saliva from wild boars with a view to the possibility of monitoring diagnostic studies in african swine fever.

Selected materials for keeping baits – fabrics made of cotton and rough natural fabric (burlap) that absorb moisture well and resistant to tearing. These fabrics were produced 18 sacks width of 30 cm and a height of 50 cm. As baits were used acorns and grains corn. Corn is used in dry and fermented. The experiment testing the method with respect to the selection of saliva from wild boars agreed with the head of the State Veterinary and Phytosanitary Service of Ukraine and the Chief of Veterinary Medicine in Kyiv region. Approbation of the experiment carried out in the forestry and hunting grounds of Brovarsky district, Kyiv region. Experiments carried out twice for the purpose of testing in different seasons (winter and summer). The first experiment was conducted in winter from 09.02 to 17.02, and the second – in the summer from 09.06 to 21.06.2013 year. In the first experiment, after placing baits within five days of daily observation, eating was not observed. Only on the 6th day were reported characteristic of wild boar tracks approach baits and eating for 2 days. Detailed examination of the testifying of the experiment fairly easy access to the delights of wild boars as cotton fabric was torn with no signs of chewing.

In the second experiment, after placing baits within 7-days of daily observation was not seen them eating. But on the 8th day were reported to approach wild boar baits and eating them for 4 days. Careful examination of the place of the experiment, evidence of no easy access to the delights of wild boars as burlap fabric on all bags were crumpled with the presence of one or several (2–3) gaps in bands up to 12 cm by 5 or holes the size of a chicken egg to child head. In the field of tissue chewing latter was similar to the carefully tousled mass fibers which were irregularly intertwined in various ways. In the experiments after eating delights with scissors, cut off the parts of the fabric, where it was the biggest eye contact (damage) of oral boars. With each bag were taken 2 tissue samples ranging from 1,0 to 3,0 cm each tissue sample were collected in a sterile plastic container (tubes, vials), and placed under labeling to thermos with coolant. After sampling remains pouches were removed from the trees. Selected samples delivered to the swine diseases laboratory and biotechnology IBM NAAS and stored at –20º C.

Species identification of biological material (saliva) in selected tissue samples was performed by analysis of mitochondrial DNA in the department of breeding and genetics. Institute of pig and agroindustrial production of the National Academy of Agrarian Sciences of Ukraine. At the same equipment used for setting the PCR and specific oligonucleotide primers – forward MITPRO2F: сatacaaatatgtgaccccaaa and reverse MITPROR: gTgAgCATgggCTgATTAgTC. In order to identify the species in paper presents data on the detection by polymerase chain reaction the presence of mitochondrial DNA in tissues of wild boars for keeping baits (in six tissue samples from nine investigated). The results of the study it can be concluded, however, that in the process of eating baits, animals, chewing and tearing cloth bags left saliva, which was annexations epithelium of the mouth and snout skin epithelium. We believe that this mitochondrial DNA of epithelial cells was detected by PCR setting. Application of the developed method of selection of saliva from wild boar as monitoring studies on african swine fever is a basis, as the agent of infection in the pathogenesis of the disease is able to accumulate and stand out from all the secrets and excreta from the body of sick animals and animals infected. Thus it should be noted that our proposed method of producing lifetime of saliva from wild boars using baits are effective.

Key words: wild boars, baits, saliva, polymerase chain reaction, mitochondrial DNA.

1. Experemental transmission of hog cholera virus in pigs / [W. Hermanns, G. Trautwein, H. Meyer, B. Liess] // Zbl. Vet. Med.: B. – 1981. – Vol. 28. – P.669–683.

2. Preparation of african swine fever contingency plans / [M.L. Penrith, V. Guberty, K. Depner, J. Lubroth]. – Rome : FAO Animal production and health. – 2009. – № 8. – 69 p.

3. Good practices for biosecurity in the pig sector / FAO Animal production and health // Rome, 2010. – № 169. – 74 p.

4. Penrith M.L. Review of african swine fever: transmission, spread and control / M.L. Penrith, W. Vosloo // Tydskr. S. Afr. Vet. Ver. – 2009. – № 80. – Vol. 2. – P. 58–62.

5. Beskontaktnyj metod otbora sljuny u dikogo kabana pri afrikanskoj chume svinej / [A.Ju. Chichikin, I.H. Gazaev, S.Zh. Cybanov, D.V. Kolbasov] // Veterinarija. – 2012. – № 6. – S. 26–28.

6. Majnhardt H. Moja zhizn' sredi kabanov / Hajnc Majnhardt; per. s nem. A.I.Cyganova; pod red. kand. biol. nauk G.I. Ivanovoj. – M.: Lesnaja promyshlennost', 1983. – 128 s.

7. Bodenchuk M. Materialy treningu z epizootologii' rozshyrenoi' tematyky, shhodo monitoryngu zahvorjuvan', jaki poshyrjujut'sja z dykoi' pryrody dlja specialistiv z veterynarnoi' medycyny. – Kyi'v, 15–18 kvitnja 2013 r.

8. Pochernjajev K.F. Vyznachennja gaplotypiv svynej z vykorystannjam metodu porodospecyfichnogo PLR-PDRF mitohondrial'noi' DNK // Veterynarna biotehnologija. – 2005. – № 6. – S. 138–143.

9. Jepizootologija i infekcionnye bolezni sel'skohozjajstvennyh zhivotnyh / [A.A. Konopatkin, I.A. Bakulov, Ja.V. Nujkin i dr.]; pod red. A.A. Konopatkina. – M.: Kolos, 1984. – S. 351–357.